Peptide Gaussian accelerated molecular dynamics

Peptide Gaussian accelerated molecular dynamics

Spotlight on Select New Antimicrobial Innate Immune Peptides Discovered during 2015-2019

Background: Antibiotic resistance is a global issue and new antimicrobials are required.

Introduction: Antimicrobial peptides are important players of host innate immune systems that protect us from infection. Due to their ability to eliminate drug-resistant pathogens, AMPs are promising candidates for developing the next generation of antimicrobials.

Methods: The antimicrobial peptide database provides a useful tool for searching, predicting, and designing new AMPs. During 2015-2019, ~500 new natural peptides have been registered.

Results: This article highlights a select set of new AMP members with interesting properties. Teixobactin is a cell wall inhibiting peptide antibiotic, while darobactin inhibits a chaperone and translocator for outer membrane proteins. Remarkably, cOB1, a sex pheromone from commensal enterococci, restricts the growth of multidrug-resistant Enterococcus faecalis in the gut at a picomolar concentration.

A novel proline-rich AMP has been found in a plant Brassica napus. A shrimp peptide MjPen-II comprises three different sequence domains: serine-rich, proline-rich, and cysteine-rich regions. Surprisingly, an amphibian peptide urumin specifically inhibits H1 hemagglutinin-bearing influenza A virus.

Defensins are abundant and typically consist of three pairs of intramolecular disulfide bonds. However, rat rattusin dimerizes via forming five pairs of intermolecular disulfide bonds. While human LL-37 can be induced by vitamin D, vitamin A induces the expression of resistin-like molecule alpha (RELMα) in mice. The isolation and characterization of an alternative human cathelicidin peptide, TLN-58, substantiates the concept of one gene multiple peptides. The involvement of a fly AMP nemuri in sleep induction may promote the research on the relationship between sleep and infection control.

Conclusion: The functional roles of AMPs continue to grow and the general term “innate immune peptides” becomes useful. These discoveries widen our view on antimicrobial peptides and may open new opportunities for developing novel peptide therapeutics for different applications.

epitoolkit

Recombinant Sterol Carrier Protein 2 (SCP2)

4-RPC835Ra01
  • EUR 433.31
  • EUR 219.00
  • EUR 1349.92
  • EUR 516.64
  • EUR 933.28
  • EUR 353.00
  • EUR 3224.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11915
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Sterol Carrier Protein 2 expressed in: E.coli

Sterol Carrier Protein 2 (SCP2) Antibody

20-abx131373
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

20-abx131374
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

20-abx141739
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx038200-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx034040-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx034040-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

20-abx006772
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx026860-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx026860-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

20-abx320284
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

20-abx322258
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237652-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237653-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237654-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Sterol Carrier Protein 2 (SCP2) Protein

20-abx650203
  • EUR 578.00
  • EUR 258.00
  • EUR 1692.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Sterol Carrier Protein 2 (SCP2) Protein

20-abx650204
  • EUR 606.00
  • EUR 258.00
  • EUR 1831.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Sterol Carrier Protein 2 (SCP2) ELISA Kit

abx383064-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human)

4-PAC835Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat)

4-PAC835Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC

4-PAC835Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Biotinylated

4-PAC835Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Cy3

4-PAC835Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), FITC

4-PAC835Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), HRP

4-PAC835Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), PE

4-PAC835Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC

4-PAC835Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Biotinylated

4-PAC835Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Cy3

4-PAC835Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), FITC

4-PAC835Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), HRP

4-PAC835Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), PE

4-PAC835Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC-Cy7

4-PAC835Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC-Cy7

4-PAC835Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 Antibody

20-abx115858
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol carrier protein 2 Antibody

abx431575-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-Sterol carrier protein 2 antibody

STJ71576 100 µg
EUR 359

SCP2 sterol-binding domain containing 1 Protein

20-abx263414
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2D1 SCP2 sterol-binding domain containing 1 Human Recombinant Protein

PROTQ9UJQ7 Regular: 10ug
EUR 317
Description: SCP2D1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.SCP2D1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Polyclonal Sterol carrier protein 2 Antibody (internal region)

APR10298G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Sterol carrier protein 2 (internal region). This antibody is tested and proven to work in the following applications:

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2 Recombinant Protein (Human)

RP027781 100 ug Ask for price

SCP2 Recombinant Protein (Human)

RP027784 100 ug Ask for price

SCP2 Recombinant Protein (Rat)

RP227723 100 ug Ask for price

SCP2 Recombinant Protein (Mouse)

RP170345 100 ug Ask for price

Recombinant purified (>98%) Human FAS Ligand Protein (carrier free)

FASL15-R-2 2 ug
EUR 347

Scp2/ Rat Scp2 ELISA Kit

ELI-44038r 96 Tests
EUR 886

SCP2 siRNA

20-abx904812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCP2 antibody

70R-3015 50 ug
EUR 467
Description: Rabbit polyclonal SCP2 antibody raised against the middle region of SCP2

SCP2 Antibody

39403-100ul 100ul
EUR 390

SCP2 Antibody

43535-100ul 100ul
EUR 252

SCP2 siRNA

20-abx932653
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCP2 siRNA

20-abx932654
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCP2 Antibody

1-CSB-PA020856DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SCP2 Antibody

1-CSB-PA020856ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SCP2 Antibody

1-CSB-PA020856ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SCP2 Antibody

1-CSB-PA020856GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-SCP2

YF-PA14533 50 ug
EUR 363
Description: Mouse polyclonal to SCP2

anti-SCP2

YF-PA14534 100 ug
EUR 403
Description: Rabbit polyclonal to SCP2

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein

PROTP04090-2 25ug
EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Murine IL-2 Protein

PROTP04351-2 20ug
EUR 317
Description: IL-2 is a powerful immunoregulatory lymphokine produced by T-cells in response to antigenic or mitogenic stimulation. IL-2/IL-2R signaling is required for T-cell proliferation and other fundamental functions which are essential for the immune response. IL-2 stimulates growth and differentiation of B-cells, NK cells, lymphokine activated killer cells, monocytes, macrophages and oligodendrocytes. Recombinant murine IL-2 is a 17.2 kDa protein, containing 149 amino acid residues.

Recombinant Human PAI-2 Protein

PROTP05120-2 10ug
EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein

PROTP08253-2 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

Mouse FGF-2 Recombinant Protein

R00121-2 5ug/vial
EUR 259
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast.

Chicken IL-2 Recombinant Protein

R00387-2 5ug/vial
EUR 259
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Chicken IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

Recombinant Human TFF-2 Protein

PROTQ03403-2 20ug
EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer

PROTP12643-2 Regular: 20ug
EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

ErbB2 ErbB-2 Human Recombinant Protein

PROTP04626-2 Regular: 20ug
EUR 317
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

IL-2 Interleukin-2 Human Recombinant Protein, His Tag

PROTP60568-2 Regular: 10ug
EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

SCP2 Conjugated Antibody

C43535 100ul
EUR 397

SCP2 cloning plasmid

CSB-CL020856HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 432
  • Sequence: atgggttttccggaagccgccagttcttttagaactcatcaaattgaagctgttccaaccagctctgcaagtgatggatttaaggcaaatcttgtttttaaggagattgagaagaaacttgaagaggaaggggaacagtttgtgaagaaaatcggtggtatttttgccttcaaggt
  • Show more
Description: A cloning plasmid for the SCP2 gene.

SCP2 cloning plasmid

CSB-CL020856HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgtcctcttccccgtgggagcctgcgaccctgcgccgggtgttcgtggtgggggttggcatgaccaagtttgtgaagcctggagctgagaattcaagagactaccctgacttggcagaagaagcaggcaagaaggctttagctgatgcacagatcccttattcagcagtggacca
  • Show more
Description: A cloning plasmid for the SCP2 gene.

anti- SCP2 antibody

FNab07652 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: sterol carrier protein 2
  • Uniprot ID: P22307
  • Gene ID: 6342
  • Research Area: Metabolism
Description: Antibody raised against SCP2

anti- SCP2 antibody

FNab07653 100µg
EUR 548.75
  • Immunogen: sterol carrier protein 2
  • Uniprot ID: P22307
  • Gene ID: 6342
  • Research Area: Metabolism
Description: Antibody raised against SCP2

anti- SCP2 antibody

FNab07654 100µg
EUR 585
  • Immunogen: sterol carrier protein 2
  • Uniprot ID: P22307
  • Gene ID: 6342
  • Research Area: Metabolism
Description: Antibody raised against SCP2

SCP2 Rabbit pAb

A5382-100ul 100 ul
EUR 308

SCP2 Rabbit pAb

A5382-200ul 200 ul
EUR 459

SCP2 Rabbit pAb

A5382-20ul 20 ul
EUR 183

SCP2 Rabbit pAb

A5382-50ul 50 ul
EUR 223

SCP2 Polyclonal Antibody

A54392 100 µg
EUR 570.55
Description: reagents widely cited

Anti-SCP2 Antibody

A1414-100
EUR 370

SCP2 Blocking Peptide

33R-6715 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCP2 antibody, catalog no. 70R-3015

Anti-SCP2 antibody

PAab07652 100 ug
EUR 386

Anti-SCP2 antibody

PAab07653 100 ug
EUR 386

Anti-SCP2 antibody

PAab07654 100 ug
EUR 412

Anti-SCP2 antibody

STJ27335 100 µl
EUR 277
Description: This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.

Recombinant Human TGF-Beta 2 (insect derived) Protein

PROTP61812-2 10ug
EUR 317
Description: The three mammalian isoforms of TGF-β, TGF-β1, β2, β3, signal through the same receptor and elicit similar biological responses. They are multifunctional cytokines that regulate cell proliferation, growth, differentiation and motility as well as synthesis and deposition of the extracellular matrix. They are involved in various physiological processes including embryogenesis, tissue remodeling and wound healing. They are secreted predominantly as latent complexes which are stored at the cell surface and in the extracellular matrix. The release of biologically active TGF-β isoform from a latent complex involves proteolytic processing of the complex and /or induction of conformational changes by proteins such as thrombospondin-1. TGF-β2 has been shown to exert suppressive effects on IL-2 dependent T-cell growth, and may also have an autocrine function in enhancing tumor growth by suppressing immuno-surveillance of tumor development. Recombinant human TGF-β2 is a 25.0 kDa protein composed of two identical 112 amino acid polypeptide chains linked by a single disulfide bond.
* Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc.

SCP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2104303 1.0 ug DNA
EUR 154

Scp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4797203 1.0 ug DNA
EUR 154

Scp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6784603 1.0 ug DNA
EUR 154

AHSG Alpha-2-HS-Glycoprotein Human Recombinant Protein HEK

PROTP02765-2 Regular: 10ug
EUR 317
Description: AHSG Human Recombinant produced by transfected human cells is a single polypeptide chain containing 357 amino acids (19-367). AHSG is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

FGF-2 Fibroblast Growth Factor-Basic Human Recombinant Protein

PROTP09038-2 Regular: 50ug
EUR 317
Description: Fibroblast Growth Factor-2 Human Recombinant (FGF-2) produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 154 amino acids and having a molecular mass of 17.2kDa.;The FGF-b is purified by proprietary chromatographic techniques.

TIMP2 Tissue Inhibitor of Metalloprotease 2 Human Recombinant Protein

PROTP16035-2 Regular: 20ug
EUR 317
Description: TIMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 194 amino acids and having a molecular mass of 21.8kDa. 

Sterol O-Acyltransferase 2 (SOAT2) Antibody

20-abx321144
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 2 (SOAT2) Antibody

20-abx321997
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 2 (SOAT2) Antibody

abx238098-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

20-abx115859
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

20-abx003038
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

abx025838-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

abx025838-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

20-abx005230
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBP2) Antibody

20-abx218757
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody

20-abx334108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

abx238221-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody

20-abx241423
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody

20-abx242399
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein

PROTP20333-2 Regular: 20ug
EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

PLGF2 Human, Placenta Growth Factor-2 Human Recombinant Protein, CHO

PROTP49763-2 Regular: 25ug
EUR 317
Description: PLGF2 Human Recombinant (19-170 a.a.) produced in CHO is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 33kDa.;The PLGF-2 Human Recombinant protein is purified by proprietary chromatographic techniques.

B2M Human, Beta 2 Microglobulin Human Recombinant Protein, His Tag

PROTP61769-2 Regular: 5ug
EUR 317
Description: B2M Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 120 amino acids (1-119 a.a.) and having a molecular mass of 14 kDa. The B2M is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

LCN2 Neutrophil Gelatinase Associated Lipocalin/Lipocalin-2 Human Recombinant Protein

PROTP80188-2 Regular: 10ug
EUR 317
Description: LCN2 Human Recombinant produced in E.Coli is a homodimeric non-glycosylated polypeptide chains consisting of two 178 amino acids and having a molecular mass of 41.0kDa. 

Recombinant human Sterol regulatory element-binding protein 2 (SREBP2) protein control for WB

SREBP23-C 100 ul
EUR 286

Rat SCP2 shRNA Plasmid

20-abx985105
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCP2 ELISA KIT|Human

EF002763 96 Tests
EUR 689

Human SCP2 shRNA Plasmid

20-abx954277
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SCP2 shRNA Plasmid

20-abx972590
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCP2 Antibody, HRP conjugated

1-CSB-PA020856DB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCP2 Antibody, FITC conjugated

1-CSB-PA020856DC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCP2 Antibody, Biotin conjugated

1-CSB-PA020856DD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Peptide Gaussian accelerated molecular dynamics (Pep-GaMD): Enhanced sampling and free energy and kinetics calculations of peptide binding

  • Peptides mediate up to 40% of known protein-protein interactions in higher eukaryotes and play an important role in cellular signaling. However, it is challenging to simulate both binding and unbinding of peptides and calculate peptide binding free energies through conventional molecular dynamics, due to long biological timescales and extremely high flexibility of the peptides.
  • Based on the Gaussian accelerated molecular dynamics (GaMD) enhanced sampling technique, we have developed a new computational method “Pep-GaMD,” which selectively boosts essential potential energy of the peptide in order to effectively model its high flexibility. In addition, another boost potential is applied to the remaining potential energy of the entire system in a dual-boost algorithm.
  • Pep-GaMD has been demonstrated on binding of three model peptides to the SH3 domains. Independent 1 µs dual-boost Pep-GaMD simulations have captured repetitive peptide dissociation and binding events, which enable us to calculate peptide binding thermodynamics and kinetics.
  • The calculated binding free energies and kinetic rate constants agreed very well with available experimental data. Furthermore, the all-atom Pep-GaMD simulations have provided important insights into the mechanism of peptide binding to proteins that involves long-range electrostatic interactions and mainly conformational selection. In summary, Pep-GaMD provides a highly efficient, easy-to-use approach for unconstrained enhanced sampling and calculations of peptide binding free energies and kinetics.

Automatic construction of molecular similarity networks for visual graph mining in chemical space of bioactive peptides: an unsupervised learning approach

  • The increasing interest in bioactive peptides with therapeutic potentials has been reflected in a large variety of biological databases published over the last years.
  • However, the knowledge discovery process from these heterogeneous data sources is a nontrivial task, becoming the essence of our research endeavor.
  • Therefore, we devise a unified data model based on molecular similarity networks for representing a chemical reference space of bioactive peptides, having an implicit knowledge that is currently not explicitly accessed in existing biological databases.
  • Indeed, our main contribution is a novel workflow for the automatic construction of such similarity networks, enabling visual graph mining techniques to uncover new insights from the “ocean” of known bioactive peptides.
  • The workflow presented here relies on the following sequential steps: (i) calculation of molecular descriptors by applying statistical and aggregation operators on amino acid property vectors; (ii) a two-stage unsupervised feature selection method to identify an optimized subset of descriptors using the concepts of entropy and mutual information; (iii) generation of sparse networks where nodes represent bioactive peptides, and edges between two nodes denote their pairwise similarity/distance relationships in the defined descriptor space; and (iv) exploratory analysis using visual inspection in combination with clustering and network science techniques.
  • For practical purposes, the proposed workflow has been implemented in our visual analytics software tool, to assist researchers in extracting useful information from an integrated collection of 45120 bioactive peptides, which is one of the largest and most diverse data in its field.
  • Finally, we illustrate the applicability of the proposed workflow for discovering central nodes in molecular similarity networks that may represent a biologically relevant chemical space known to date.

131I-metaiodobenzylguanidine and peptide receptor radionuclide therapy in pheochromocytoma and paraganglioma

 Purpose of review: Pheochromocytomas and paragangliomas are rare tumors arising, respectively, from the adrenal medulla and extra-adrenal sympathetic or parasympathetic paraganglia. The main therapeutic objectives in case of metastatic disease are the reduction of tumor burden and the control of symptoms resulting from excessive catecholamine secretion.

Treatment choices constitute not only a wait and see attitude, locoregional approaches, chemotherapy regiments but also radiopharmaceutical agents, and they should be discussed in a specialized multidisciplinary board. This review will briefly discuss the radiopharmaceutical modalities in patients with pheochromocytomas and paragangliomas (I-MIBG and PRRT).

Recent findings: I-MIBG (Azedra) has received FDA approval for patients with iobenguane-scan-positive, unresectable, locally advanced or metastatic pheochromocytomas and paragangliomas who require systemic anticancer therapy, whereas peptide receptor radionuclide therapy using radiolabelled somatostatin analogues is currently performed in compassionate use, with very promising results.

No prospective head-to-head comparison between the modalities has been conducted to date.

Summary: Promising results have been reported for both radiopharmaceutical agents, mostly in the setting of retrospective series. No prospective head-to-head comparison between the modalities is yet available.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Mu-96T 96T
EUR 635
  • Should the Mouse Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Mu-48Tests 48 Tests
EUR 489

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Mu-96Tests 96 Tests
EUR 677

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Mu-48Tests 48 Tests
EUR 511

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Mu-96Tests 96 Tests
EUR 709

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-b-48T 48T
EUR 547
  • Should the Bovine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-b-96T 96T
EUR 715
  • Should the Bovine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Canine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-c-48T 48T
EUR 527
  • Should the Canine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Canine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-c-96T 96T
EUR 688
  • Should the Canine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Equine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Eq-48T 48T
EUR 556
  • Should the Equine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Equine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Eq-96T 96T
EUR 728
  • Should the Equine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Hu-48T 48T
EUR 366
  • Should the Human Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Hu-96T 96T
EUR 465
  • Should the Human Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-p-48T 48T
EUR 547
  • Should the Porcine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-p-96T 96T
EUR 715
  • Should the Porcine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Ra-48T 48T
EUR 508
  • Should the Rat Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Ra-96T 96T
EUR 661
  • Should the Rat Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Si-48T 48T
EUR 576
  • Should the Monkey Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Si-96T 96T
EUR 755
  • Should the Monkey Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-b-48Tests 48 Tests
EUR 555

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-b-96Tests 96 Tests
EUR 771

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-c-48Tests 48 Tests
EUR 533

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-c-96Tests 96 Tests
EUR 740

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Eq-48Tests 48 Tests
EUR 566

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Eq-96Tests 96 Tests
EUR 787

Human Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Hu-48Tests 48 Tests
EUR 350

Human Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Hu-96Tests 96 Tests
EUR 479

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-p-48Tests 48 Tests
EUR 555

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-p-96Tests 96 Tests
EUR 771

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Ra-48Tests 48 Tests
EUR 511

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Ra-96Tests 96 Tests
EUR 709

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Si-48Tests 48 Tests
EUR 587

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Si-96Tests 96 Tests
EUR 818

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-b-48Tests 48 Tests
EUR 580

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-b-96Tests 96 Tests
EUR 807

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-c-48Tests 48 Tests
EUR 557

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-c-96Tests 96 Tests
EUR 774

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Eq-48Tests 48 Tests
EUR 591

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Eq-96Tests 96 Tests
EUR 823

Human Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Hu-48Tests 48 Tests
EUR 365

Human Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Hu-96Tests 96 Tests
EUR 500

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-p-48Tests 48 Tests
EUR 580

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-p-96Tests 96 Tests
EUR 807

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Ra-48Tests 48 Tests
EUR 534

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Ra-96Tests 96 Tests
EUR 742

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Si-48Tests 48 Tests
EUR 614

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Si-96Tests 96 Tests
EUR 856

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Bo01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3SZ57
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.6kDa
  • Isoelectric Point: 6
Description: Recombinant Bovine Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Ca01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJU5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Hu01
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27435
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.5kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Hu02
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27435
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 75.2kDa
  • Isoelectric Point: 5.5
Description: Recombinant Human Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02772
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.7kDa
  • Isoelectric Point: 5.7
Description: Recombinant Mouse Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Po01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.6kDa
  • Isoelectric Point: 5.8
Description: Recombinant Pig Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Po02
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 46.1kDa
  • Isoelectric Point: 6
Description: Recombinant Pig Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Po03
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 52.9kDa
  • Isoelectric Point: 5.9
Description: Recombinant Pig Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

4-RPA153Ra01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02773
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 49.7kDa
  • Isoelectric Point: 6.2
Description: Recombinant Rat Alpha-Fetoprotein expressed in: E.coli

Mouse Alpha-fetoprotein (Afp)

1-CSB-YP001421MO
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in Yeast

Mouse Alpha-fetoprotein (Afp)

1-CSB-EP001421MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in E.coli

Mouse Alpha-fetoprotein (Afp)

1-CSB-EP001421MOe1
  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in E.coli

Mouse Alpha-Fetoprotein (aFP) Protein

20-abx065265
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx123962
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx125411-50ul 50 ul
EUR 411
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx125498
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx116775
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx128500
  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx129944
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx109521
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx109522
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx110374
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx000589
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

alpha-Fetoprotein (AFP) Antibody

abx139033-01mg 0.1 mg
EUR 328
  • Shipped within 5-12 working days.

alpha-Fetoprotein (AFP) Antibody

abx139034-01mg 0.1 mg
EUR 328
  • Shipped within 5-12 working days.

Alpha Fetoprotein (AFP) Antibody

20-abx159320
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha Fetoprotein (AFP) Antibody

abx159321-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx171175
  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx171176
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

20-abx171177
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

20-abx171178
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx171179
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

20-abx171180
  • EUR 954.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha Fetoprotein (AFP) Protein

abx061589-1mg 1 mg
EUR 829
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx101417
  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx101418
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx101419
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx101420
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx101421
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx101422
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (AFP) Antibody

abx037404-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx104868
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (AFP) Antibody

abx022523-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx022524-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025195-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025195-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025196-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027957-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027957-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027958-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027958-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx015762-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx018327-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx019011-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020102-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020507-1mg 1 mg
EUR 662
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020508-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020509-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020510-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020512-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020513-1mg 1 mg
EUR 690
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020514-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020515-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020561-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

20-abx175346
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

20-abx175347
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

20-abx175348
  • EUR 1316.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

20-abx175349
  • EUR 1372.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (AFP) Antibody

20-abx323614
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

alpha-Fetoprotein (AFP) Antibody

abx432318-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx211421
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx211423
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx230203-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx210158
  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx210165
  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx210375
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

20-abx210376
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) ELISA

K4242-100
EUR 664

AFP Alpha-Fetoprotein Human

PROTP02771 Regular: 50ug
EUR 317
Description: Human alpha-fetoprotein purified from human cord serum, shows a 70kDa band on SDS-PAGE.